Tutorial I: UCE Phylogenomics
In the following example, we are going to process raw read data from UCE enrichments performed against several divergent taxa so that you can get a feel for how a typical analysis goes. For more general analysis notes, see the UCE Processing for Phylogenomics chapter. That said, this is a good place to start.
The taxa we are working with will be:
Mus musculus (PE100)
Anolis carolinensis (PE100)
Alligator mississippiensis (PE150)
Gallus gallus (PE250)
Download the data
You can download the data from figshare (http://dx.doi.org/10.6084/m9.figshare.1284521). If you want to use the command line, you can use something like:
# create a project directory
mkdir uce-tutorial
# change to that directory
cd uce-tutorial
# download the data into a file names fastq.zip
wget -O fastq.zip https://ndownloader.figshare.com/articles/1284521/versions/2
# make a directory to hold the data
mkdir raw-fastq
# move the zip file into that directory
mv fastq.zip raw-fastq
# move into the directory we just created
cd raw-fastq
# unzip the fastq data
unzip fastq.zip
# delete the zip file
rm fastq.zip
# you should see 6 files in this directory now
ls -l
-rw-r--r--. 1 bcf users 4.4M Feb 22 14:14 Alligator_mississippiensis_GGAGCTATGG_L001_R1_001.fastq.gz
-rw-r--r--. 1 bcf users 4.3M Feb 22 14:14 Alligator_mississippiensis_GGAGCTATGG_L001_R2_001.fastq.gz
-rw-r--r--. 1 bcf users 4.9M Feb 22 14:14 Anolis_carolinensis_GGCGAAGGTT_L001_R1_001.fastq.gz
-rw-r--r--. 1 bcf users 4.9M Feb 22 14:15 Anolis_carolinensis_GGCGAAGGTT_L001_R2_001.fastq.gz
-rw-r--r--. 1 bcf users 7.6M Feb 22 14:15 Gallus_gallus_TTCTCCTTCA_L001_R1_001.fastq.gz
-rw-r--r--. 1 bcf users 8.4M Feb 22 14:15 Gallus_gallus_TTCTCCTTCA_L001_R2_001.fastq.gz
-rw-r--r--. 1 bcf users 4.9M Feb 22 14:16 Mus_musculus_CTACAACGGC_L001_R1_001.fastq.gz
-rw-r--r--. 1 bcf users 4.9M Feb 22 14:16 Mus_musculus_CTACAACGGC_L001_R2_001.fastq.gz
Alternatively, if you think of the filesystem as a tree-like structure, the directory in which we are working (uce-tutorial) would look like:
uce-tutorial
└── raw-fastq
├── Alligator_mississippiensis_GGAGCTATGG_L001_R1_001.fastq.gz
├── Alligator_mississippiensis_GGAGCTATGG_L001_R2_001.fastq.gz
├── Anolis_carolinensis_GGCGAAGGTT_L001_R1_001.fastq.gz
├── Anolis_carolinensis_GGCGAAGGTT_L001_R2_001.fastq.gz
├── Gallus_gallus_TTCTCCTTCA_L001_R1_001.fastq.gz
├── Gallus_gallus_TTCTCCTTCA_L001_R2_001.fastq.gz
├── Mus_musculus_CTACAACGGC_L001_R1_001.fastq.gz
└── Mus_musculus_CTACAACGGC_L001_R2_001.fastq.gz
If you do not want to use the command line, you can download the data using the figshare interface or by clicking:
Count the read data
Usually, we want a count of the actual number of reads in a given sequence file for a given species. We can do this several ways, but here, we’ll use tools from unix, because they are fast. The next line of code will count the lines in each R1 file (which should be equal to the reads in the R2 file) and divide that number by 4 to get the number of sequence reads.
for i in *_R1_*.fastq.gz; do echo $i; gunzip -c $i | wc -l | awk '{print $1/4}'; done
You should see:
Alligator_mississippiensis_GGAGCTATGG_L001_R1_001.fastq.gz
50000
Anolis_carolinensis_GGCGAAGGTT_L001_R1_001.fastq.gz
50000
Gallus_gallus_TTCTCCTTCA_L001_R1_001.fastq.gz
50000
Mus_musculus_CTACAACGGC_L001_R1_001.fastq.gz
50000
Notice that all the read counts are equal - that is because these 50,000 reads in each R1 and R2 file were subsampled, randomly, from a file of many more reads.
Clean the read data
The data you just downloaded are actual, raw, untrimmed fastq data. This means they contain adapter contamination and low quality bases. We need to remove these - which you can do several ways. We’ll use another program that I wrote (illumiprocessor) because it allows us to trim many different indexed adapters from individual-specific fastq files - something that is a pain to do by hand. That said, you can certainly trim your reads however you would like. See the illumiprocessor website for instructions on installing the program.
To use this program, we will create a configuration file that we will use to inform the program about which adapters are in which READ1 and READ2 files. The data we are trimming, here, are from TruSeq v3 libraries, but the indexes are 10 nucleotides long. We will set up the trimming file with these parameters, but please see the illumiprocessor documentation for other options.
# this is the section where you list the adapters you used. the asterisk
# will be replaced with the appropriate index for the sample.
[adapters]
i7:AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC*ATCTCGTATGCCGTCTTCTGCTTG
i5:AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
# this is the list of indexes we used
[tag sequences]
BFIDT-166:GGAGCTATGG
BFIDT-016:GGCGAAGGTT
BFIDT-045:TTCTCCTTCA
BFIDT-011:CTACAACGGC
# this is how each index maps to each set of reads
[tag map]
Alligator_mississippiensis_GGAGCTATGG:BFIDT-166
Anolis_carolinensis_GGCGAAGGTT:BFIDT-016
Gallus_gallus_TTCTCCTTCA:BFIDT-045
Mus_musculus_CTACAACGGC:BFIDT-011
# we want to rename our read files something a bit more nice - so we will
# rename Alligator_mississippiensis_GGAGCTATGG to alligator_mississippiensis
[names]
Alligator_mississippiensis_GGAGCTATGG:alligator_mississippiensis
Anolis_carolinensis_GGCGAAGGTT:anolis_carolinensis
Gallus_gallus_TTCTCCTTCA:gallus_gallus
Mus_musculus_CTACAACGGC:mus_musculus
I create this file in a directory above the one holding my reads, so the structure looks like:
uce-tutorial
├── illumiprocessor.conf
└── raw-fastq
├── Alligator_mississippiensis_GGAGCTATGG_L001_R1_001.fastq.gz
├── Alligator_mississippiensis_GGAGCTATGG_L001_R2_001.fastq.gz
├── Anolis_carolinensis_GGCGAAGGTT_L001_R1_001.fastq.gz
├── Anolis_carolinensis_GGCGAAGGTT_L001_R2_001.fastq.gz
├── Gallus_gallus_TTCTCCTTCA_L001_R1_001.fastq.gz
├── Gallus_gallus_TTCTCCTTCA_L001_R2_001.fastq.gz
├── Mus_musculus_CTACAACGGC_L001_R1_001.fastq.gz
└── Mus_musculus_CTACAACGGC_L001_R2_001.fastq.gz
Now I run illumiprocessor against the data. Note that I am using 4 physical CPU cores to do this work. You need to use the number of physical cores available on your machine, although there is not sense in using more cores than you have taxa (in this case).
# go to the directory containing our config file and data
cd uce-tutorial
# run illumiprocessor
illumiprocessor \
--input raw-fastq/ \
--output clean-fastq \
--config illumiprocessor.conf \
--cores 4
The output should look like the following:
2021-02-22 14:59:26,488 - illumiprocessor - INFO - ==================== Starting illumiprocessor ===================
2021-02-22 14:59:26,489 - illumiprocessor - INFO - Version: 2.0.9
2021-02-22 14:59:26,489 - illumiprocessor - INFO - Argument --config: illumiprocessor.conf
2021-02-22 14:59:26,489 - illumiprocessor - INFO - Argument --cores: 4
2021-02-22 14:59:26,489 - illumiprocessor - INFO - Argument --input: /scratch/bfaircloth/uce-tutorial/raw-fastq
2021-02-22 14:59:26,490 - illumiprocessor - INFO - Argument --log_path: None
2021-02-22 14:59:26,490 - illumiprocessor - INFO - Argument --min_len: 40
2021-02-22 14:59:26,490 - illumiprocessor - INFO - Argument --no_merge: False
2021-02-22 14:59:26,490 - illumiprocessor - INFO - Argument --output: /scratch/bfaircloth/uce-tutorial/clean-fastq
2021-02-22 14:59:26,490 - illumiprocessor - INFO - Argument --phred: phred33
2021-02-22 14:59:26,491 - illumiprocessor - INFO - Argument --r1_pattern: None
2021-02-22 14:59:26,491 - illumiprocessor - INFO - Argument --r2_pattern: None
2021-02-22 14:59:26,491 - illumiprocessor - INFO - Argument --se: False
2021-02-22 14:59:26,491 - illumiprocessor - INFO - Argument --trimmomatic: /home/bcf/conda/envs/phyluce/bin/trimmomatic
2021-02-22 14:59:26,491 - illumiprocessor - INFO - Argument --verbosity: INFO
2021-02-22 14:59:26,904 - illumiprocessor - INFO - Trimming samples with Trimmomatic
Running....
2021-02-22 14:59:36,754 - illumiprocessor - INFO - =================== Completed illumiprocessor ===================
Notice that the program has created a log file showing what it did, and it has also created a new directory holding the clean data that has the name clean-fastq (what you told it to name the directory). Within that new directory, there are taxon-specific folder for the cleaned reads. More specifically, your directory structure should look similar to the following (I’ve collapsed the list of raw-reads):
uce-tutorial
├── clean-fastq
│ ├── alligator_mississippiensis
│ ├── anolis_carolinensis
│ ├── gallus_gallus
│ └── mus_musculus
├── illumiprocessor.conf
├── illumiprocessor.log
└── raw-fastq
Within each organism specific directory, there are more files and folders:
uce-tutorial
├── clean-fastq
│ ├── alligator_mississippiensis
│ │ ├── adapters.fasta
│ │ ├── raw-reads
│ │ ├── split-adapter-quality-trimmed
│ │ └── stats
│ ├── anolis_carolinensis
│ │ ├── adapters.fasta
│ │ ├── raw-reads
│ │ ├── split-adapter-quality-trimmed
│ │ └── stats
│ ├── gallus_gallus
│ │ ├── adapters.fasta
│ │ ├── raw-reads
│ │ ├── split-adapter-quality-trimmed
│ │ └── stats
│ └── mus_musculus
│ ├── adapters.fasta
│ ├── raw-reads
│ ├── split-adapter-quality-trimmed
│ └── stats
├── illumiprocessor.conf
├── illumiprocessor.log
└── raw-fastq
And, within each of those directories nested within the species-specific directory, there are additional files or links to files:
uce-tutorial
├── clean-fastq
│ ├── alligator_mississippiensis
│ │ ├── adapters.fasta
│ │ ├── raw-reads
│ │ │ ├── alligator_mississippiensis-READ1.fastq.gz -> <PATH>
│ │ │ └── alligator_mississippiensis-READ2.fastq.gz -> <PATH>
│ │ ├── split-adapter-quality-trimmed
│ │ │ ├── alligator_mississippiensis-READ1.fastq.gz
│ │ │ ├── alligator_mississippiensis-READ2.fastq.gz
│ │ │ └── alligator_mississippiensis-READ-singleton.fastq.gz
│ │ └── stats
│ │ └── alligator_mississippiensis-adapter-contam.txt
│ ├── anolis_carolinensis
│ ├── gallus_gallus
│ └── mus_musculus
├── illumiprocessor.conf
├── illumiprocessor.log
└── raw-fastq
I have collapsed the listing to show only the first taxon.
The -> in the raw-reads directory above means there are symlinks to the files. I have removed the file paths and replaced them with <PATH> so that the figure will fit on a page.
The really important information is in the split-adapter-quality-trimmed directory - which now holds our reads that have had adapter-contamination and low-quality bases removed. Within this split-adapter-quality-trimmed directory, the READ1 and READ2 files hold reads that remain in a pair (the reads are in the same consecutive order in each file). The READ-singleton file holds READ1 reads OR READ2 reads that lost their “mate” or “paired-read” because of trimming or removal.
Quality control
You might want to get some idea of what effect the trimming has on read counts and overall read lengths. There are certainly other (better) tools out there to do this (like FastQC), but you can get a reasonable idea of how good your reads are by running the following, which will output a CSV listing of read stats by sample:
# move to the directory holding our cleaned reads
cd clean-fastq/
# run this script against all directories of reads
for i in *;
do
phyluce_assembly_get_fastq_lengths --input $i/split-adapter-quality-trimmed/ --csv;
done
The output you see should look like this:
All files in dir with alligator_mississippiensis-READ1.fastq.gz,93699,8418476,89.84595353205476,0.059508742244529164,40,100,100.0
All files in dir with anolis_carolinensis-READ-singleton.fastq.gz,92184,8401336,91.13659637247244,0.048890234925557836,40,100,100.0
All files in dir with gallus_gallus-READ1.fastq.gz,99444,21218771,213.37406982824504,0.16122899415574637,40,251,250.0
All files in dir with mus_musculus-READ2.fastq.gz,89841,8165734,90.89095179261139,0.052266485638855914,40,100,100.
Now, we’re ready to assemble our reads.
Assemble the data
phyluce has several options for assembly - you can use velvet, abyss, or spades. For this tutorial, we are going to use spades, because it seems to works best for most purposes, it is easy to install and run, and it works consistently. The helper programs for the other assemblers use the same config file, so you can easily experiment with all of the assemblers.
To run an assembly, we need to create a another configuration file. The assembly configuration file looks like the following, assuming we want to assemble all of our data from the organisms above:
[samples]
alligator_mississippiensis:/path/to/the/uce-tutorial/clean-fastq/alligator_mississippiensis/split-adapter-quality-trimmed/
anolis_carolinensis:/path/to/the/uce-tutorial/clean-fastq/anolis_carolinensis/split-adapter-quality-trimmed/
gallus_gallus:/path/to/the/uce-tutorial/clean-fastq/gallus_gallus/split-adapter-quality-trimmed/
mus_musculus:/path/to/the/uce-tutorial/clean-fastq/mus_musculus/split-adapter-quality-trimmed/
You need to modify this file to use the path to the clean read data on your computer (/path/to/the/ is a placeholder, here). You will save this into a file named assembly.conf at the top of our uce-tutorial directory:
uce-tutorial
├── assembly.conf
├── clean-fastq
├── illumiprocessor.conf
├── illumiprocessor.log
├── phyluce_assembly_assemblo_trinity.log
├── raw-fastq
└── trinity-assemblies
If you want to change the names on the left hand side of the colon in the config file, you can do so, but the paths on the right hand side need to point to our “clean” UCE raw reads. If you have files in multiple locations, you can use any number of different paths on the right-hand side of the colon.
Attention
Although you can easily input new PATHs in this file, the structure of the data below the PATH you use must be the same - meaning that the structure and naming scheme for READ1, READ2, and READ-singleton must be the same. Or, put another way, the assembly programs for phyluce assume the data always look like the following:
<some working folder name>
└── clean-fastq
├── alligator_mississippiensis
│ └── split-adapter-quality-trimmed
│ ├── alligator_mississippiensis-READ1.fastq.gz
│ ├── alligator_mississippiensis-READ2.fastq.gz
│ └── alligator_mississippiensis-READ-singleton.fastq.gz
└── anolis_carolinensis
└── split-adapter-quality-trimmed
├── anolis_carolinensis-READ1.fastq.gz
├── anolis_carolinensis-READ2.fastq.gz
└── anolis_carolinensis-READ-singleton.fastq.gz
Now that we have that file created, copy it to our working directory, and run the phyluce_assembly_assemblo_spades program:
# make sure we are at the top-level of our uce tutorial directory
cd uce-tutorial
# run the assembly
phyluce_assembly_assemblo_spades \
--conf assembly.conf \
--output spades-assemblies \
--cores 12
Warning
Note that I am using 12 physical CPU cores to do this work. You
need to use the number of physical cores available on your machine. phyluce_assembly_assemblo_spades assumes you have at least 8 GB of RAM
on your system, and it is better to have much more. If you use more
CPU cores than you have or you specify more RAM than you have, the job
can fail.
You can adjust the RAM dedicated to the job using the --memory option,
which takes an integer value (in GB RAM).
As the assembly proceeds, you should see output similar to the following:
2021-02-26 21:12:16,615 - phyluce_assembly_assemblo_spades - INFO - =========== Starting phyluce_assembly_assemblo_spades ===========
2021-02-26 21:12:16,615 - phyluce_assembly_assemblo_spades - INFO - Version: 1.7.0
2021-02-26 21:12:16,615 - phyluce_assembly_assemblo_spades - INFO - Commit: None
2021-02-26 21:12:16,615 - phyluce_assembly_assemblo_spades - INFO - Argument --config: /data/assembly.conf
2021-02-26 21:12:16,616 - phyluce_assembly_assemblo_spades - INFO - Argument --cores: 12
2021-02-26 21:12:16,616 - phyluce_assembly_assemblo_spades - INFO - Argument --dir: None
2021-02-26 21:12:16,616 - phyluce_assembly_assemblo_spades - INFO - Argument --do_not_clean: False
2021-02-26 21:12:16,616 - phyluce_assembly_assemblo_spades - INFO - Argument --log_path: None
2021-02-26 21:12:16,616 - phyluce_assembly_assemblo_spades - INFO - Argument --memory: 8
2021-02-26 21:12:16,616 - phyluce_assembly_assemblo_spades - INFO - Argument --output: /data/spades-assemblies
2021-02-26 21:12:16,616 - phyluce_assembly_assemblo_spades - INFO - Argument --subfolder:
2021-02-26 21:12:16,616 - phyluce_assembly_assemblo_spades - INFO - Argument --verbosity: INFO
2021-02-26 21:12:16,617 - phyluce_assembly_assemblo_spades - INFO - Getting input filenames and creating output directories
2021-02-26 21:12:16,765 - phyluce_assembly_assemblo_spades - INFO - ------------- Processing alligator_mississippiensis -------------
2021-02-26 21:12:16,775 - phyluce_assembly_assemblo_spades - INFO - Finding fastq/fasta files
2021-02-26 21:12:16,787 - phyluce_assembly_assemblo_spades - INFO - File type is fastq
2021-02-26 21:12:16,787 - phyluce_assembly_assemblo_spades - INFO - Running SPAdes for PE data
2021-02-26 21:13:35,643 - phyluce_assembly_assemblo_spades - INFO - Symlinking assembled contigs into /data/spades-assemblies/contigs
...[continued]...
2021-02-26 21:19:06,618 - phyluce_assembly_assemblo_spades - INFO - Symlinking assembled contigs into /data/spades-assemblies/contigs
2021-02-26 21:19:06,624 - phyluce_assembly_assemblo_spades - INFO - =========== Completed phyluce_assembly_assemblo_spades ==========
One the assembly is finished, have a look at the directory structure:
uce-tutorial
├── assembly.conf
├── clean-fastq
├── illumiprocessor.conf
├── illumiprocessor.log
├── phyluce_assembly_assemblo_trinity.log
├── raw-fastq
└── spades-assemblies
├── alligator_mississippiensis_trinity
│ ├── contigs.fasta
│ ├── scaffolds.fasta
│ └── spades.log
├── anolis_carolinensis_trinity
│ ├── contigs.fasta
│ ├── scaffolds.fasta
│ └── spades.log
├── contigs
│ ├── alligator_mississippiensis.contigs.fasta -> ../alligator_mississippiensis_trinity/contigs.fasta
│ ├── anolis_carolinensis.contigs.fasta -> ../anolis_carolinensis_trinity/contigs.fasta
│ ├── gallus_gallus.contigs.fasta -> ../gallus_gallus_trinity/contigs.fasta
│ └── mus_musculus.contigs.fasta -> ../mus_musculus_trinity/contigs.fasta
├── gallus_gallus_trinity
│ ├── contigs.fasta
│ ├── scaffolds.fasta
│ └── spades.log
└── mus_musculus_trinity
├── contigs.fasta
├── scaffolds.fasta
└── spades.log
Your species-specific assembly files are in the spades-assemblies directory nested within species-specific directories that correspond to the name you used in the assembly.conf file (to the left of the colon).
There is also a contigs directory within this folder. The contigs directory is the important one, because it contains symlinks to all of the species- specific contigs. This means that you can treat this single folder as if it contains all of your assembled contigs.
Assembly QC
We can get a sense of how well the assembly worked by running the following from the top of our working directory:
# run this script against all directories of reads
for i in spades-assemblies/contigs/*.fasta;
do
phyluce_assembly_get_fasta_lengths --input $i --csv;
done
This should output something similar to the following. I’ve added the header as a comment:
# samples,contigs,total bp,mean length,95 CI length,min length,max length,median legnth,contigs >1kb
alligator_mississippiensis.contigs.fasta,870,220436,253.37471264367815,6.9967833874072225,56,3831,236.0,5
anolis_carolinensis.contigs.fasta,1136,355837,313.2367957746479,8.00195622090676,56,3182,243.0,9
gallus_gallus.contigs.fasta,5228,2841631,543.5407421576128,2.8905564028218618,56,4117,495.5,107
mus_musculus.contigs.fasta,1395,324498,232.61505376344087,6.895305881534584,56,1646,88.0,13
Question: Why are my numbers slightly different than your numbers?
The process of read assembly often differs by operating system and sometimes by OS version, and some of these differences are due to libraries that underlie many of the assembly programs. Expect to see differences. You should not expect for them to be huge.
Attention
If you see max-contig sizes around 16KB (for vertebrates), that is commonly the entire or almost-entire mtDNA genome. You do not tend to see entire mtDNA assemblies when the input DNA was extracted from a source having few mitochondria (e.g. blood).
There are many, many other assembly QC steps you can run other than simply looking at the stats of the assembled contigs. We will not go into those here.
Finding UCE loci
Now that we’ve assembled our contigs from raw reads, it’s time to find those contigs which are UCE loci and move aside those that are not. The directory structure before we do this should look like the following:
uce-tutorial
├── assembly.conf
├── clean-fastq
├── illumiprocessor.conf
├── illumiprocessor.log
├── phyluce_assembly_assemblo_trinity.log
├── raw-fastq
└── trinity-assemblies
Before we locate UCE loci, you need to get the probe set used for the enrichments:
wget https://raw.githubusercontent.com/faircloth-lab/uce-probe-sets/refs/heads/master/V1/uce-5k-probe-set/uce-5k-probes.fasta
Now, our directory structure looks like:
uce-tutorial
├── assembly.conf
├── clean-fastq
├── illumiprocessor.conf
├── illumiprocessor.log
├── phyluce_assembly_assemblo_trinity.log
├── raw-fastq
├── trinity-assemblies
└── uce-5k-probes.fasta
Now, run the phyluce_assembly_match_contigs_to_probes program:
phyluce_assembly_match_contigs_to_probes \
--contigs spades-assemblies/contigs \
--probes uce-5k-probes.fasta \
--output uce-search-results
You should see output similar to the following (also stored in phyluce_assembly_assemblo_trinity.log):
2021-02-26 21:37:43,108 - phyluce_assembly_match_contigs_to_probes - INFO - ======= Starting phyluce_assembly_match_contigs_to_probes =======
2021-02-26 21:37:43,108 - phyluce_assembly_match_contigs_to_probes - INFO - Version: 1.7.0
2021-02-26 21:37:43,109 - phyluce_assembly_match_contigs_to_probes - INFO - Commit: None
2021-02-26 21:37:43,109 - phyluce_assembly_match_contigs_to_probes - INFO - Argument --contigs: /data/spades-assemblies/contigs
2021-02-26 21:37:43,109 - phyluce_assembly_match_contigs_to_probes - INFO - Argument --csv: test-output.csv
2021-02-26 21:37:43,109 - phyluce_assembly_match_contigs_to_probes - INFO - Argument --dupefile: None
2021-02-26 21:37:43,110 - phyluce_assembly_match_contigs_to_probes - INFO - Argument --keep_duplicates: None
2021-02-26 21:37:43,110 - phyluce_assembly_match_contigs_to_probes - INFO - Argument --log_path: None
2021-02-26 21:37:43,110 - phyluce_assembly_match_contigs_to_probes - INFO - Argument --min_coverage: 80
2021-02-26 21:37:43,110 - phyluce_assembly_match_contigs_to_probes - INFO - Argument --min_identity: 80
2021-02-26 21:37:43,110 - phyluce_assembly_match_contigs_to_probes - INFO - Argument --output: /data/uce-search-results
2021-02-26 21:37:43,111 - phyluce_assembly_match_contigs_to_probes - INFO - Argument --probes: /data/uce-5k-probes.fasta
2021-02-26 21:37:43,111 - phyluce_assembly_match_contigs_to_probes - INFO - Argument --regex: ^(uce-\d+)(?:_p\d+.*)
2021-02-26 21:37:43,111 - phyluce_assembly_match_contigs_to_probes - INFO - Argument --verbosity: INFO
2021-02-26 21:37:43,225 - phyluce_assembly_match_contigs_to_probes - INFO - Creating the UCE-match database
2021-02-26 21:37:43,266 - phyluce_assembly_match_contigs_to_probes - INFO - Processing contig data
2021-02-26 21:37:43,266 - phyluce_assembly_match_contigs_to_probes - INFO - -----------------------------------------------------------------
2021-02-26 21:37:44,680 - phyluce_assembly_match_contigs_to_probes - INFO - alligator_mississippiensis: 422 (48.51%) uniques of 870 contigs, 0 dupe probe matches, 3 UCE loci removed for matching multiple contigs, 2 contigs removed for matching multiple UCE loci
2021-02-26 21:37:45,940 - phyluce_assembly_match_contigs_to_probes - INFO - anolis_carolinensis: 399 (35.12%) uniques of 1136 contigs, 0 dupe probe matches, 0 UCE loci removed for matching multiple contigs, 2 contigs removed for matching multiple UCE loci
2021-02-26 21:37:53,686 - phyluce_assembly_match_contigs_to_probes - INFO - gallus_gallus: 3492 (66.79%) uniques of 5228 contigs, 0 dupe probe matches, 22 UCE loci removed for matching multiple contigs, 37 contigs removed for matching multiple UCE loci
2021-02-26 21:37:54,853 - phyluce_assembly_match_contigs_to_probes - INFO - mus_musculus: 324 (23.23%) uniques of 1395 contigs, 0 dupe probe matches, 0 UCE loci removed for matching multiple contigs, 1 contigs removed for matching multiple UCE loci
2021-02-26 21:37:54,853 - phyluce_assembly_match_contigs_to_probes - INFO - -----------------------------------------------------------------
2021-02-26 21:37:54,853 - phyluce_assembly_match_contigs_to_probes - INFO - The LASTZ alignments are in /data/uce-search-results
2021-02-26 21:37:54,854 - phyluce_assembly_match_contigs_to_probes - INFO - The UCE match database is in /data/uce-search-results/probe.matches.sqlite
2021-02-26 21:37:54,854 - phyluce_assembly_match_contigs_to_probes - INFO - ======= Completed phyluce_assembly_match_contigs_to_probes ======
The header info at the top tells us exactly what version of the code we are running and keeps track of our options. The important output is:
alligator_mississippiensis: 422 (48.51%) uniques of 870 contigs, 0 dupe probe matches, 3 UCE loci removed for matching multiple contigs, 2 contigs removed for matching multiple UCE loci
anolis_carolinensis: 399 (35.12%) uniques of 1136 contigs, 0 dupe probe matches, 0 UCE loci removed for matching multiple contigs, 2 contigs removed for matching multiple UCE loci
gallus_gallus: 3492 (66.79%) uniques of 5228 contigs, 0 dupe probe matches, 22 UCE loci removed for matching multiple contigs, 37 contigs removed for matching multiple UCE loci
mus_musculus: 324 (23.23%) uniques of 1395 contigs, 0 dupe probe matches, 0 UCE loci removed for matching multiple contigs, 1 contigs removed for matching multiple UCE loci
Which we can break down to the following (for alligator_mississippiensis):
alligator_mississippiensis:
422 (48.51%) uniques of 870 contigs
0 dupe probe matches
3 UCE loci removed for matching multiple contigs
2 contigs removed for matching multiple UCE loci
These are the capture data for the alligator_mississippiensis sample. We targeted 5k UCE loci in this sample and recovered roughly 422 of those loci in this subsampled set of reads. Before reaching that total of 422 loci, we removed 3 UCE loci and 2 contigs from the data set because they looked like duplicates (probes supposedly targeting different loci hit the same contig or two supposedly different contigs hit probes designed for a single UCE locus).
Question: Why is the count of UCE loci different by sample?
For these example data, we enriched some samples (alligator_mississippiensis and gallus_gallus) for 5k UCE loci, while we enriched others (anolis_carolinensis and mus_musculus) for 2.5k UCE loci. Additionally, the 2.5k UCE enrichments did not work very well (operator error). Finally, because we have subsampled the data to make the files of reasonable size for the tutorial, that process removes lots of read that would have assembled into UCE contigs (e.g., if we use ALL the data, we recover 4000+ UCE contigs for alligator).
The directory structure now looks like the following (everything collapsed but the uce-search-results directory):
uce-tutorial
├── assembly.conf
├── clean-fastq
├── illumiprocessor.conf
├── illumiprocessor.log
├── phyluce_assembly_assemblo_trinity.log
├── phyluce_assembly_match_contigs_to_probes.log
├── raw-fastq
├── trinity-assemblies
├── uce-5k-probes.fasta
└── uce-search-results
├── alligator_mississippiensis.contigs.lastz
├── anolis_carolinensis.contigs.lastz
├── gallus_gallus.contigs.lastz
├── mus_musculus.contigs.lastz
└── probe.matches.sqlite
The search we just ran created lastz search result files for each taxon, and stored summary results of these searches in the probe.matches.sqlite database (see The probe.matches.sqlite database for more information on this database and its structure).
Extracting UCE loci
Now that we have located UCE loci, we need to determine which taxa we want in our analysis, create a list of those taxa, and then generate a list of which UCE loci we enriched in each taxon (the “data matrix configuration file”). We will then use this list to extract FASTA data for each taxon for each UCE locus.
First, we need to decide which taxa we want in our “taxon set”. So, we create a configuration file like so:
[all]
alligator_mississippiensis
anolis_carolinensis
gallus_gallus
mus_musculus
These names need to match the assembly names we used. Here, we have just put all 4 taxa in a list that we named all. However, we can adjust this list in many ways (see Creating a data matrix configuration file).
Save this file as taxon-set.conf at the top level of our uce-tutorial directory. The directory should look like this, now:
uce-tutorial
├── assembly.conf
├── clean-fastq
├── illumiprocessor.conf
├── illumiprocessor.log
├── phyluce_assembly_assemblo_trinity.log
├── phyluce_assembly_match_contigs_to_probes.log
├── raw-fastq
├── taxon-set.conf
├── trinity-assemblies
├── uce-5k-probes.fasta
└── uce-search-results
Now that we have this file created, we do the following to create the initial list of loci for each taxon:
# create an output directory for this taxon set - this just keeps
# things neat
cd uce-tutorial
mkdir -p taxon-sets/all
# create the data matrix configuration file
phyluce_assembly_get_match_counts \
--locus-db uce-search-results/probe.matches.sqlite \
--taxon-list-config taxon-set.conf \
--taxon-group 'all' \
--incomplete-matrix \
--output taxon-sets/all/all-taxa-incomplete.conf
The output should look like the following:
2021-03-01 15:46:14,277 - phyluce_assembly_get_match_counts - INFO - =========== Starting phyluce_assembly_get_match_counts ==========
2021-03-01 15:46:14,278 - phyluce_assembly_get_match_counts - INFO - Version: 1.7.0
2021-03-01 15:46:14,278 - phyluce_assembly_get_match_counts - INFO - Commit: None
2021-03-01 15:46:14,278 - phyluce_assembly_get_match_counts - INFO - Argument --extend_locus_db: None
2021-03-01 15:46:14,278 - phyluce_assembly_get_match_counts - INFO - Argument --incomplete_matrix: True
2021-03-01 15:46:14,278 - phyluce_assembly_get_match_counts - INFO - Argument --keep_counts: False
2021-03-01 15:46:14,278 - phyluce_assembly_get_match_counts - INFO - Argument --locus_db: /data/uce-search-results/probe.matches.sqlite
2021-03-01 15:46:14,278 - phyluce_assembly_get_match_counts - INFO - Argument --log_path: None
2021-03-01 15:46:14,278 - phyluce_assembly_get_match_counts - INFO - Argument --optimize: False
2021-03-01 15:46:14,279 - phyluce_assembly_get_match_counts - INFO - Argument --output: /data/taxon-sets/all/all-taxa-incomplete.conf
2021-03-01 15:46:14,279 - phyluce_assembly_get_match_counts - INFO - Argument --random: False
2021-03-01 15:46:14,279 - phyluce_assembly_get_match_counts - INFO - Argument --sample_size: 10
2021-03-01 15:46:14,279 - phyluce_assembly_get_match_counts - INFO - Argument --samples: 10
2021-03-01 15:46:14,279 - phyluce_assembly_get_match_counts - INFO - Argument --silent: False
2021-03-01 15:46:14,279 - phyluce_assembly_get_match_counts - INFO - Argument --taxon_group: all
2021-03-01 15:46:14,279 - phyluce_assembly_get_match_counts - INFO - Argument --taxon_list_config: /data/taxon-set.conf
2021-03-01 15:46:14,280 - phyluce_assembly_get_match_counts - INFO - Argument --verbosity: INFO
2021-03-01 15:46:14,319 - phyluce_assembly_get_match_counts - INFO - There are 4 taxa in the taxon-group '[all]' in the config file taxon-set.conf
2021-03-01 15:46:14,319 - phyluce_assembly_get_match_counts - INFO - Getting UCE names from database
2021-03-01 15:46:44,488 - phyluce_assembly_get_match_counts - INFO - There are 5041 total UCE loci in the database
2021-03-01 15:46:44,567 - phyluce_assembly_get_match_counts - INFO - Getting UCE matches by organism to generate a INCOMPLETE matrix
2021-03-01 15:46:44,569 - phyluce_assembly_get_match_counts - INFO - There are 3653 UCE loci in an INCOMPLETE matrix
2021-03-01 15:46:44,569 - phyluce_assembly_get_match_counts - INFO - Writing the taxa and loci in the data matrix to /data/taxon-sets/all/all-taxa-incomplete.conf
2021-03-01 15:46:44,574 - phyluce_assembly_get_match_counts - INFO - ========== Completed phyluce_assembly_get_match_counts ==========
And, our directory structure should now look like this (collapsing all but taxon-sets):
uce-tutorial
├── assembly.conf
├── clean-fastq
├── illumiprocessor.conf
├── illumiprocessor.log
├── phyluce_assembly_assemblo_trinity.log
├── phyluce_assembly_get_match_counts.log
├── phyluce_assembly_match_contigs_to_probes.log
├── taxon-set.conf
├── taxon-sets
│ └── all
│ └── all-taxa-incomplete.conf
├── trinity-assemblies
├── uce-5k-probes.fasta
└── uce-search-results
Now, we need to extract FASTA data that correspond to the loci in all-taxa-incomplete.conf:
# change to the taxon-sets/all directory
cd taxon-sets/all
# make a log directory to hold our log files - this keeps things neat
mkdir log
# get FASTA data for taxa in our taxon set
phyluce_assembly_get_fastas_from_match_counts \
--contigs ../../spades-assemblies/contigs \
--locus-db ../../uce-search-results/probe.matches.sqlite \
--match-count-output all-taxa-incomplete.conf \
--output all-taxa-incomplete.fasta \
--incomplete-matrix all-taxa-incomplete.incomplete \
--log-path log
The output should look something like the following:
2021-03-01 15:47:55,574 - phyluce_assembly_get_fastas_from_match_counts - INFO - ===== Starting phyluce_assembly_get_fastas_from_match_counts ====
2021-03-01 15:47:55,575 - phyluce_assembly_get_fastas_from_match_counts - INFO - Version: 1.7.0
2021-03-01 15:47:55,575 - phyluce_assembly_get_fastas_from_match_counts - INFO - Commit: None
2021-03-01 15:47:55,575 - phyluce_assembly_get_fastas_from_match_counts - INFO - Argument --contigs: /data/spades-assemblies/contigs
2021-03-01 15:47:55,575 - phyluce_assembly_get_fastas_from_match_counts - INFO - Argument --extend_locus_contigs: None
2021-03-01 15:47:55,575 - phyluce_assembly_get_fastas_from_match_counts - INFO - Argument --extend_locus_db: None
2021-03-01 15:47:55,575 - phyluce_assembly_get_fastas_from_match_counts - INFO - Argument --incomplete_matrix: /data/taxon-sets/all/all-taxa-incomplete.incomplete
2021-03-01 15:47:55,576 - phyluce_assembly_get_fastas_from_match_counts - INFO - Argument --locus_db: /data/uce-search-results/probe.matches.sqlite
2021-03-01 15:47:55,576 - phyluce_assembly_get_fastas_from_match_counts - INFO - Argument --log_path: /data/taxon-sets/all/log
2021-03-01 15:47:55,576 - phyluce_assembly_get_fastas_from_match_counts - INFO - Argument --match_count_output: /data/taxon-sets/all/all-taxa-incomplete.conf
2021-03-01 15:47:55,576 - phyluce_assembly_get_fastas_from_match_counts - INFO - Argument --output: /data/taxon-sets/all/all-taxa-incomplete.fasta
2021-03-01 15:47:55,576 - phyluce_assembly_get_fastas_from_match_counts - INFO - Argument --verbosity: INFO
2021-03-01 15:47:55,609 - phyluce_assembly_get_fastas_from_match_counts - INFO - There are 4 taxa in the match-count-config file named all-taxa-incomplete.conf
2021-03-01 15:47:55,612 - phyluce_assembly_get_fastas_from_match_counts - INFO - There are 3653 UCE loci in an INCOMPLETE matrix
2021-03-01 15:47:55,614 - phyluce_assembly_get_fastas_from_match_counts - INFO - ---------Getting UCE loci for alligator_mississippiensis---------
2021-03-01 15:47:55,925 - phyluce_assembly_get_fastas_from_match_counts - INFO - There are 422 UCE loci for alligator_mississippiensis
2021-03-01 15:47:55,925 - phyluce_assembly_get_fastas_from_match_counts - INFO - Parsing and renaming contigs for alligator_mississippiensis
2021-03-01 15:47:56,396 - phyluce_assembly_get_fastas_from_match_counts - INFO - Writing missing locus information to /data/taxon-sets/all/all-taxa-incomplete.incomplete
2021-03-01 15:47:56,399 - phyluce_assembly_get_fastas_from_match_counts - INFO - -------------Getting UCE loci for anolis_carolinensis------------
2021-03-01 15:47:56,638 - phyluce_assembly_get_fastas_from_match_counts - INFO - There are 399 UCE loci for anolis_carolinensis
2021-03-01 15:47:56,638 - phyluce_assembly_get_fastas_from_match_counts - INFO - Parsing and renaming contigs for anolis_carolinensis
2021-03-01 15:47:57,077 - phyluce_assembly_get_fastas_from_match_counts - INFO - Replaced <20 ambiguous bases (N) in 7 contigs for anolis_carolinensis
2021-03-01 15:47:57,077 - phyluce_assembly_get_fastas_from_match_counts - INFO - Writing missing locus information to /data/taxon-sets/all/all-taxa-incomplete.incomplete
2021-03-01 15:47:57,079 - phyluce_assembly_get_fastas_from_match_counts - INFO - ----------------Getting UCE loci for gallus_gallus---------------
2021-03-01 15:47:58,940 - phyluce_assembly_get_fastas_from_match_counts - INFO - There are 3492 UCE loci for gallus_gallus
2021-03-01 15:47:58,940 - phyluce_assembly_get_fastas_from_match_counts - INFO - Parsing and renaming contigs for gallus_gallus
2021-03-01 15:48:01,965 - phyluce_assembly_get_fastas_from_match_counts - INFO - Writing missing locus information to /data/taxon-sets/all/all-taxa-incomplete.incomplete
2021-03-01 15:48:01,966 - phyluce_assembly_get_fastas_from_match_counts - INFO - ----------------Getting UCE loci for mus_musculus----------------
2021-03-01 15:48:02,168 - phyluce_assembly_get_fastas_from_match_counts - INFO - There are 324 UCE loci for mus_musculus
2021-03-01 15:48:02,168 - phyluce_assembly_get_fastas_from_match_counts - INFO - Parsing and renaming contigs for mus_musculus
2021-03-01 15:48:02,508 - phyluce_assembly_get_fastas_from_match_counts - INFO - Writing missing locus information to /data/taxon-sets/all/all-taxa-incomplete.incomplete
2021-03-01 15:48:02,519 - phyluce_assembly_get_fastas_from_match_counts - INFO - ==== Completed phyluce_assembly_get_fastas_from_match_counts ====
And, our directory structure should now look like this (collapsing all but taxon-sets):
uce-tutorial
├── assembly.conf
├── clean-fastq
├── illumiprocessor.conf
├── illumiprocessor.log
├── phyluce_assembly_assemblo_trinity.log
├── phyluce_assembly_get_match_counts.log
├── phyluce_assembly_match_contigs_to_probes.log
├── taxon-set.conf
├── taxon-sets
│ └── all
│ ├── all-taxa-incomplete.conf
│ ├── all-taxa-incomplete.fasta
│ ├── all-taxa-incomplete.incomplete
│ └── log
│ └── phyluce_assembly_get_fastas_from_match_counts.log
└── phyluce_assembly_get_fastas_from_match_counts.log
├── trinity-assemblies
├── uce-5k-probes.fasta
└── uce-search-results
The extracted FASTA data are in a monolithic FASTA file (all data for all organisms) named all-taxa-incomplete.fasta.
Exploding the monolithic FASTA file
Lots of times we want to know individual statistics on UCE assemblies for a given taxon. We can do that by exploding the monolithic fasta file into a file of UCE loci that we have enriched by taxon, then running stats on those exploded files. To do that, run the following:
# explode the monolithic FASTA by taxon (you can also do by locus)
phyluce_assembly_explode_get_fastas_file \
--input all-taxa-incomplete.fasta \
--output exploded-fastas \
--by-taxon
# get summary stats on the FASTAS
for i in exploded-fastas/*.fasta;
do
phyluce_assembly_get_fasta_lengths --input $i --csv;
done
# samples,contigs,total bp,mean length,95 CI length,min length,max length,median legnth,contigs >1kb
alligator-mississippiensis.unaligned.fasta,422,118864,281.66824644549763,9.03914154267783,206,3831,250.5,1
anolis-carolinensis.unaligned.fasta,399,206926,518.6115288220551,11.261692813904311,206,1115,525.0,1
gallus-gallus.unaligned.fasta,3492,2157267,617.7740549828179,3.075870593111506,307,1503,607.0,81
mus-musculus.unaligned.fasta,324,188082,580.5,13.930004844688803,207,1058,623.5,6
Aligning UCE loci
You have lots of options when aligning UCE loci. You can align the loci and use those alignments with no trimming, you can edge-trim the alignments following some algorithm, and you can end+internally trim alignments following some algorithm. It’s hard to say what is best in all situations. When taxa are “closely” related (< 30-50 MYA, perhaps), I think that edge-trimming alignments is reasonable. When the taxa you are interested in span a wider range of divergence times (> 50 MYA), you may want to think about internal trimming.
How you accomplish you edge- or internal-trimming is also a decision you need to make. In phyluce, we implement our edge-trimming algorithm by running the alignment program “as-is” (i.e., without the –no-trim) option. We do internal-trimming by turning off trimming using –no-trim, then passing the resulting alignments (in FASTA format) to a parallel wrapper around Gblocks.
You also have a choice of aligner - mafft or muscle (or you can externally align UCE loci using a tool like SATé, as well).
Generally, I would use mafft.
Edge trimming
Edge trimming your alignments is a relatively simple matter. You can run edge trimming, as follows:
# make sure we are in the correct directory
cd uce-tutorial/taxon-sets/all
# align the data
phyluce_align_seqcap_align \
--input all-taxa-incomplete.fasta \
--output mafft-nexus-edge-trimmed \
--taxa 4 \
--aligner mafft \
--cores 12 \
--incomplete-matrix \
--log-path log
Warning
Note that I am using 12 physical CPU cores here. You need to use the number of physical cores available on your machine.
The output should look like this:
2021-03-01 15:51:21,854 - phyluce_align_seqcap_align - INFO - ============== Starting phyluce_align_seqcap_align ==============
2021-03-01 15:51:21,855 - phyluce_align_seqcap_align - INFO - Version: 1.7.0
2021-03-01 15:51:21,855 - phyluce_align_seqcap_align - INFO - Commit: None
2021-03-01 15:51:21,856 - phyluce_align_seqcap_align - INFO - Argument --aligner: mafft
2021-03-01 15:51:21,856 - phyluce_align_seqcap_align - INFO - Argument --ambiguous: False
2021-03-01 15:51:21,856 - phyluce_align_seqcap_align - INFO - Argument --cores: 12
2021-03-01 15:51:21,856 - phyluce_align_seqcap_align - INFO - Argument --input: /data/taxon-sets/all/all-taxa-incomplete.fasta
2021-03-01 15:51:21,857 - phyluce_align_seqcap_align - INFO - Argument --log_path: /data/taxon-sets/all/log
2021-03-01 15:51:21,857 - phyluce_align_seqcap_align - INFO - Argument --max_divergence: 0.2
2021-03-01 15:51:21,857 - phyluce_align_seqcap_align - INFO - Argument --min_length: 100
2021-03-01 15:51:21,857 - phyluce_align_seqcap_align - INFO - Argument --no_trim: False
2021-03-01 15:51:21,857 - phyluce_align_seqcap_align - INFO - Argument --notstrict: True
2021-03-01 15:51:21,858 - phyluce_align_seqcap_align - INFO - Argument --output: /data/taxon-sets/all/mafft-nexus-edge-trimmed
2021-03-01 15:51:21,858 - phyluce_align_seqcap_align - INFO - Argument --output_format: nexus
2021-03-01 15:51:21,858 - phyluce_align_seqcap_align - INFO - Argument --proportion: 0.65
2021-03-01 15:51:21,858 - phyluce_align_seqcap_align - INFO - Argument --taxa: 4
2021-03-01 15:51:21,858 - phyluce_align_seqcap_align - INFO - Argument --threshold: 0.65
2021-03-01 15:51:21,859 - phyluce_align_seqcap_align - INFO - Argument --verbosity: INFO
2021-03-01 15:51:21,859 - phyluce_align_seqcap_align - INFO - Argument --window: 20
2021-03-01 15:51:21,859 - phyluce_align_seqcap_align - INFO - Building the locus dictionary
2021-03-01 15:51:21,859 - phyluce_align_seqcap_align - INFO - Removing ALL sequences with ambiguous bases...
2021-03-01 15:51:22,328 - phyluce_align_seqcap_align - WARNING - DROPPED locus uce-4698. Too few taxa (N < 3).
[many more loci dropped here]
2021-03-01 15:51:22,750 - phyluce_align_seqcap_align - INFO - Aligning with MAFFT
2021-03-01 15:51:22,751 - phyluce_align_seqcap_align - INFO - Alignment begins. 'X' indicates dropped alignments (these are reported after alignment)
.................[continued]
2021-03-01 15:51:28,544 - phyluce_align_seqcap_align - INFO - Alignment ends
2021-03-01 15:51:28,545 - phyluce_align_seqcap_align - INFO - Writing output files
2021-03-01 15:51:28,788 - phyluce_align_seqcap_align - INFO - ============== Completed phyluce_align_seqcap_align =============
The . values that you see represent loci that were aligned and succesfully trimmed. Any X values that you see represent loci that were removed because trimming reduced their length to effectively nothing.
Attention
The number of potential alignments dropped here is abnormally large becase our sample size is so small (n=4).
The current directory structure should look like (I’ve collapsed a number of branches in the tree):
uce-tutorial
├── assembly.conf
...
├── taxon-sets
│ └── all
│ ├── all-taxa-incomplete.conf
│ ├── all-taxa-incomplete.fasta
│ ├── all-taxa-incomplete.incomplete
│ ├── exploded-fastas
│ ├── log
│ └── mafft-nexus-edge-trimmed
│ ├── uce-1008.nexus
│ ├── uce-1014.nexus
│ ├── uce-1039.nexus
│ ...
│ └── uce-991.nexus
...
└── uce-search-results
We can output summary stats for these alignments by running the following program:
phyluce_align_get_align_summary_data \
--alignments mafft-nexus-edge-trimmed \
--cores 12 \
--log-path log
Warning
Note that I am using 12 physical CPU cores here. You need to use the number of physical cores available on your machine.
The output from the program should look like:
2021-03-01 15:58:43,241 - phyluce_align_get_align_summary_data - INFO - ========= Starting phyluce_align_get_align_summary_data =========
2021-03-01 15:58:43,241 - phyluce_align_get_align_summary_data - INFO - Version: 1.7.0
2021-03-01 15:58:43,241 - phyluce_align_get_align_summary_data - INFO - Commit: None
2021-03-01 15:58:43,241 - phyluce_align_get_align_summary_data - INFO - Argument --alignments: /data/taxon-sets/all/mafft-nexus-edge-trimmed
2021-03-01 15:58:43,241 - phyluce_align_get_align_summary_data - INFO - Argument --cores: 12
2021-03-01 15:58:43,241 - phyluce_align_get_align_summary_data - INFO - Argument --input_format: nexus
2021-03-01 15:58:43,242 - phyluce_align_get_align_summary_data - INFO - Argument --log_path: /data/taxon-sets/all/log
2021-03-01 15:58:43,242 - phyluce_align_get_align_summary_data - INFO - Argument --output: None
2021-03-01 15:58:43,242 - phyluce_align_get_align_summary_data - INFO - Argument --show_taxon_counts: False
2021-03-01 15:58:43,242 - phyluce_align_get_align_summary_data - INFO - Argument --verbosity: INFO
2021-03-01 15:58:43,242 - phyluce_align_get_align_summary_data - INFO - Getting alignment files
2021-03-01 15:58:43,251 - phyluce_align_get_align_summary_data - INFO - Computing summary statistics using 12 cores
2021-03-01 15:58:43,596 - phyluce_align_get_align_summary_data - INFO - ----------------------- Alignment summary -----------------------
2021-03-01 15:58:43,597 - phyluce_align_get_align_summary_data - INFO - [Alignments] loci: 190
2021-03-01 15:58:43,597 - phyluce_align_get_align_summary_data - INFO - [Alignments] length: 86,032
2021-03-01 15:58:43,597 - phyluce_align_get_align_summary_data - INFO - [Alignments] mean: 452.80
2021-03-01 15:58:43,597 - phyluce_align_get_align_summary_data - INFO - [Alignments] 95% CI: 21.51
2021-03-01 15:58:43,597 - phyluce_align_get_align_summary_data - INFO - [Alignments] min: 126
2021-03-01 15:58:43,598 - phyluce_align_get_align_summary_data - INFO - [Alignments] max: 907
2021-03-01 15:58:43,598 - phyluce_align_get_align_summary_data - INFO - ------------------- Informative Sites summary -------------------
2021-03-01 15:58:43,598 - phyluce_align_get_align_summary_data - INFO - [Sites] loci: 190
2021-03-01 15:58:43,598 - phyluce_align_get_align_summary_data - INFO - [Sites] total: 58
2021-03-01 15:58:43,598 - phyluce_align_get_align_summary_data - INFO - [Sites] mean: 0.31
2021-03-01 15:58:43,598 - phyluce_align_get_align_summary_data - INFO - [Sites] 95% CI: 0.18
2021-03-01 15:58:43,598 - phyluce_align_get_align_summary_data - INFO - [Sites] min: 0
2021-03-01 15:58:43,599 - phyluce_align_get_align_summary_data - INFO - [Sites] max: 12
2021-03-01 15:58:43,600 - phyluce_align_get_align_summary_data - INFO - ------------------------- Taxon summary -------------------------
2021-03-01 15:58:43,600 - phyluce_align_get_align_summary_data - INFO - [Taxa] mean: 3.15
2021-03-01 15:58:43,600 - phyluce_align_get_align_summary_data - INFO - [Taxa] 95% CI: 0.05
2021-03-01 15:58:43,600 - phyluce_align_get_align_summary_data - INFO - [Taxa] min: 3
2021-03-01 15:58:43,600 - phyluce_align_get_align_summary_data - INFO - [Taxa] max: 4
2021-03-01 15:58:43,601 - phyluce_align_get_align_summary_data - INFO - ----------------- Missing data from trim summary ----------------
2021-03-01 15:58:43,601 - phyluce_align_get_align_summary_data - INFO - [Missing] mean: 9.36
2021-03-01 15:58:43,601 - phyluce_align_get_align_summary_data - INFO - [Missing] 95% CI: 0.84
2021-03-01 15:58:43,601 - phyluce_align_get_align_summary_data - INFO - [Missing] min: 0.00
2021-03-01 15:58:43,601 - phyluce_align_get_align_summary_data - INFO - [Missing] max: 32.67
2021-03-01 15:58:43,603 - phyluce_align_get_align_summary_data - INFO - -------------------- Character count summary --------------------
2021-03-01 15:58:43,603 - phyluce_align_get_align_summary_data - INFO - [All characters] 268,288
2021-03-01 15:58:43,603 - phyluce_align_get_align_summary_data - INFO - [Nucleotides] 235,385
2021-03-01 15:58:43,603 - phyluce_align_get_align_summary_data - INFO - ---------------- Data matrix completeness summary ---------------
2021-03-01 15:58:43,604 - phyluce_align_get_align_summary_data - INFO - [Matrix 50%] 190 alignments
2021-03-01 15:58:43,604 - phyluce_align_get_align_summary_data - INFO - [Matrix 55%] 190 alignments
2021-03-01 15:58:43,604 - phyluce_align_get_align_summary_data - INFO - [Matrix 60%] 190 alignments
2021-03-01 15:58:43,604 - phyluce_align_get_align_summary_data - INFO - [Matrix 65%] 190 alignments
2021-03-01 15:58:43,604 - phyluce_align_get_align_summary_data - INFO - [Matrix 70%] 190 alignments
2021-03-01 15:58:43,604 - phyluce_align_get_align_summary_data - INFO - [Matrix 75%] 190 alignments
2021-03-01 15:58:43,604 - phyluce_align_get_align_summary_data - INFO - [Matrix 80%] 29 alignments
2021-03-01 15:58:43,605 - phyluce_align_get_align_summary_data - INFO - [Matrix 85%] 29 alignments
2021-03-01 15:58:43,605 - phyluce_align_get_align_summary_data - INFO - [Matrix 90%] 29 alignments
2021-03-01 15:58:43,605 - phyluce_align_get_align_summary_data - INFO - [Matrix 95%] 29 alignments
2021-03-01 15:58:43,605 - phyluce_align_get_align_summary_data - INFO - ------------------------ Character counts -----------------------
2021-03-01 15:58:43,605 - phyluce_align_get_align_summary_data - INFO - [Characters] '-' is present 7,819 times
2021-03-01 15:58:43,605 - phyluce_align_get_align_summary_data - INFO - [Characters] '?' is present 25,084 times
2021-03-01 15:58:43,605 - phyluce_align_get_align_summary_data - INFO - [Characters] 'A' is present 70,371 times
2021-03-01 15:58:43,605 - phyluce_align_get_align_summary_data - INFO - [Characters] 'C' is present 48,431 times
2021-03-01 15:58:43,606 - phyluce_align_get_align_summary_data - INFO - [Characters] 'G' is present 41,941 times
2021-03-01 15:58:43,606 - phyluce_align_get_align_summary_data - INFO - [Characters] 'T' is present 74,642 times
2021-03-01 15:58:43,606 - phyluce_align_get_align_summary_data - INFO - ========= Completed phyluce_align_get_align_summary_data ========
Attention
Note that there are only 2 sets of counts in the Data matrix
completeness section because (1) we dropped all loci having fewer than 3
taxa and (2) that only leaves two remaining options.
The most important data here are the number of loci we have and the number of loci in data matrices of different completeness. The locus length stats are also reasonably important, but they can also be misleading because edge-trimming does not remove internal gaps that often inflate the length of alignments.
Internal trimming
Now, let’s do the same thing, but run internal trimming on the resulting alignments. We will do that by turning off trimming –no-trim and outputting FASTA formatted alignments with –output-format fasta.
# make sure we are in the correct directory
cd uce-tutorial/taxon-sets/all
# align the data - turn off trimming and output FASTA
phyluce_align_seqcap_align \
--input all-taxa-incomplete.fasta \
--output mafft-nexus-internal-trimmed \
--taxa 4 \
--aligner mafft \
--cores 12 \
--incomplete-matrix \
--output-format fasta \
--no-trim \
--log-path log
Attention
The number of UCE loci dropped here is abnormally large becase our sample size is so small (n=4).
Warning
Note that I am using 12 physical CPU cores here. You need to use the number of physical cores available on your machine.
The output from the program should be the roughly the same as what we saw before. The current directory structure should look like (I’ve collapsed a number of branches in the tree):
uce-tutorial
├── assembly.conf
...
├── taxon-sets
│ └── all
│ ├── all-taxa-incomplete.conf
│ ├── all-taxa-incomplete.fasta
│ ├── all-taxa-incomplete.incomplete
│ ├── exploded-fastas
│ ├── log
│ ├── mafft-nexus-edge-trimmed
│ └── mafft-nexus-internal-trimmed
│ ├── uce-1008.nexus
│ ├── uce-1014.nexus
│ ├── uce-1039.nexus
│ ...
│ └── uce-991.nexus
...
└── uce-search-results
Now, we are going to trim these loci using Gblocks:
# run gblocks trimming on the alignments
phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed \
--alignments mafft-nexus-internal-trimmed \
--output mafft-nexus-internal-trimmed-gblocks \
--cores 12 \
--log log
The output should look like this:
2021-03-01 16:01:38,320 - phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed - INFO - Starting phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed
2021-03-01 16:01:38,321 - phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed - INFO - Version: 1.7.0
2021-03-01 16:01:38,321 - phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed - INFO - Commit: None
2021-03-01 16:01:38,321 - phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed - INFO - Argument --alignments: /data/taxon-sets/all/mafft-nexus-internal-trimmed
2021-03-01 16:01:38,321 - phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed - INFO - Argument --b1: 0.5
2021-03-01 16:01:38,321 - phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed - INFO - Argument --b2: 0.85
2021-03-01 16:01:38,322 - phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed - INFO - Argument --b3: 8
2021-03-01 16:01:38,322 - phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed - INFO - Argument --b4: 10
2021-03-01 16:01:38,322 - phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed - INFO - Argument --cores: 12
2021-03-01 16:01:38,322 - phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed - INFO - Argument --input_format: fasta
2021-03-01 16:01:38,323 - phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed - INFO - Argument --log_path: /data/taxon-sets/all/log
2021-03-01 16:01:38,323 - phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed - INFO - Argument --output: /data/taxon-sets/all/mafft-nexus-internal-trimmed-gblocks
2021-03-01 16:01:38,323 - phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed - INFO - Argument --output_format: nexus
2021-03-01 16:01:38,323 - phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed - INFO - Argument --verbosity: INFO
2021-03-01 16:01:38,323 - phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed - INFO - Getting aligned sequences for trimming
2021-03-01 16:01:38,338 - phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed - INFO - Alignment trimming begins.
.................[continued]
2021-03-01 16:01:38,729 - phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed - INFO - Alignment trimming ends
2021-03-01 16:01:38,730 - phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed - INFO - Writing output files
2021-03-01 16:01:38,901 - phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed - WARNING - Unable to write uce-816 - alignment too short
2021-03-01 16:01:39,099 - phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed - INFO - Completed phyluce_align_get_gblocks_trimmed_alignments_from_untrimmed
The . values that you see represent loci that were aligned and succesfully trimmed. Any X values that you see represent loci that were aligned and trimmed so much that there was nothing left.
The current directory structure should look like (I’ve collapsed a number of branches in the tree):
uce-tutorial
├── assembly.conf
...
├── taxon-sets
│ └── all
│ ├── all-taxa-incomplete.conf
│ ├── all-taxa-incomplete.fasta
│ ├── all-taxa-incomplete.incomplete
│ ├── exploded-fastas
│ ├── log
│ ├── mafft-nexus-edge-trimmed
│ ├── mafft-nexus-internal-trimmed
│ └── mafft-nexus-internal-trimmed-gblocks
│ ├── uce-1008.nexus
│ ├── uce-1014.nexus
│ ├── uce-1039.nexus
│ ...
│ └── uce-991.nexus
...
└── uce-search-results
We can output summary stats for these alignments by running the following program:
phyluce_align_get_align_summary_data \
--alignments mafft-nexus-internal-trimmed-gblocks \
--cores 12 \
--log-path log
Warning
Note that I am using 12 physical CPU cores here. You need to use the number of physical cores available on your machine.
The output from the program should look like:
2021-03-01 16:03:34,322 - phyluce_align_get_align_summary_data - INFO - ========= Starting phyluce_align_get_align_summary_data =========
2021-03-01 16:03:34,322 - phyluce_align_get_align_summary_data - INFO - Version: 1.7.0
2021-03-01 16:03:34,322 - phyluce_align_get_align_summary_data - INFO - Commit: None
2021-03-01 16:03:34,323 - phyluce_align_get_align_summary_data - INFO - Argument --alignments: /data/taxon-sets/all/mafft-nexus-internal-trimmed-gblocks
2021-03-01 16:03:34,323 - phyluce_align_get_align_summary_data - INFO - Argument --cores: 12
2021-03-01 16:03:34,323 - phyluce_align_get_align_summary_data - INFO - Argument --input_format: nexus
2021-03-01 16:03:34,323 - phyluce_align_get_align_summary_data - INFO - Argument --log_path: /data/taxon-sets/all/log
2021-03-01 16:03:34,323 - phyluce_align_get_align_summary_data - INFO - Argument --output: None
2021-03-01 16:03:34,323 - phyluce_align_get_align_summary_data - INFO - Argument --show_taxon_counts: False
2021-03-01 16:03:34,323 - phyluce_align_get_align_summary_data - INFO - Argument --verbosity: INFO
2021-03-01 16:03:34,323 - phyluce_align_get_align_summary_data - INFO - Getting alignment files
2021-03-01 16:03:34,334 - phyluce_align_get_align_summary_data - INFO - Computing summary statistics using 12 cores
2021-03-01 16:03:34,641 - phyluce_align_get_align_summary_data - INFO - ----------------------- Alignment summary -----------------------
2021-03-01 16:03:34,642 - phyluce_align_get_align_summary_data - INFO - [Alignments] loci: 189
2021-03-01 16:03:34,642 - phyluce_align_get_align_summary_data - INFO - [Alignments] length: 70,380
2021-03-01 16:03:34,643 - phyluce_align_get_align_summary_data - INFO - [Alignments] mean: 372.38
2021-03-01 16:03:34,643 - phyluce_align_get_align_summary_data - INFO - [Alignments] 95% CI: 21.61
2021-03-01 16:03:34,643 - phyluce_align_get_align_summary_data - INFO - [Alignments] min: 140
2021-03-01 16:03:34,643 - phyluce_align_get_align_summary_data - INFO - [Alignments] max: 797
2021-03-01 16:03:34,644 - phyluce_align_get_align_summary_data - INFO - ------------------- Informative Sites summary -------------------
2021-03-01 16:03:34,645 - phyluce_align_get_align_summary_data - INFO - [Sites] loci: 189
2021-03-01 16:03:34,645 - phyluce_align_get_align_summary_data - INFO - [Sites] total: 69
2021-03-01 16:03:34,645 - phyluce_align_get_align_summary_data - INFO - [Sites] mean: 0.37
2021-03-01 16:03:34,645 - phyluce_align_get_align_summary_data - INFO - [Sites] 95% CI: 0.19
2021-03-01 16:03:34,646 - phyluce_align_get_align_summary_data - INFO - [Sites] min: 0
2021-03-01 16:03:34,646 - phyluce_align_get_align_summary_data - INFO - [Sites] max: 12
2021-03-01 16:03:34,648 - phyluce_align_get_align_summary_data - INFO - ------------------------- Taxon summary -------------------------
2021-03-01 16:03:34,649 - phyluce_align_get_align_summary_data - INFO - [Taxa] mean: 3.15
2021-03-01 16:03:34,649 - phyluce_align_get_align_summary_data - INFO - [Taxa] 95% CI: 0.05
2021-03-01 16:03:34,649 - phyluce_align_get_align_summary_data - INFO - [Taxa] min: 3
2021-03-01 16:03:34,650 - phyluce_align_get_align_summary_data - INFO - [Taxa] max: 4
2021-03-01 16:03:34,650 - phyluce_align_get_align_summary_data - INFO - ----------------- Missing data from trim summary ----------------
2021-03-01 16:03:34,651 - phyluce_align_get_align_summary_data - INFO - [Missing] mean: 0.00
2021-03-01 16:03:34,651 - phyluce_align_get_align_summary_data - INFO - [Missing] 95% CI: 0.00
2021-03-01 16:03:34,651 - phyluce_align_get_align_summary_data - INFO - [Missing] min: 0.00
2021-03-01 16:03:34,651 - phyluce_align_get_align_summary_data - INFO - [Missing] max: 0.00
2021-03-01 16:03:34,655 - phyluce_align_get_align_summary_data - INFO - -------------------- Character count summary --------------------
2021-03-01 16:03:34,655 - phyluce_align_get_align_summary_data - INFO - [All characters] 222,814
2021-03-01 16:03:34,655 - phyluce_align_get_align_summary_data - INFO - [Nucleotides] 215,091
2021-03-01 16:03:34,656 - phyluce_align_get_align_summary_data - INFO - ---------------- Data matrix completeness summary ---------------
2021-03-01 16:03:34,656 - phyluce_align_get_align_summary_data - INFO - [Matrix 50%] 189 alignments
2021-03-01 16:03:34,656 - phyluce_align_get_align_summary_data - INFO - [Matrix 55%] 189 alignments
2021-03-01 16:03:34,657 - phyluce_align_get_align_summary_data - INFO - [Matrix 60%] 189 alignments
2021-03-01 16:03:34,657 - phyluce_align_get_align_summary_data - INFO - [Matrix 65%] 189 alignments
2021-03-01 16:03:34,657 - phyluce_align_get_align_summary_data - INFO - [Matrix 70%] 189 alignments
2021-03-01 16:03:34,657 - phyluce_align_get_align_summary_data - INFO - [Matrix 75%] 189 alignments
2021-03-01 16:03:34,658 - phyluce_align_get_align_summary_data - INFO - [Matrix 80%] 29 alignments
2021-03-01 16:03:34,658 - phyluce_align_get_align_summary_data - INFO - [Matrix 85%] 29 alignments
2021-03-01 16:03:34,658 - phyluce_align_get_align_summary_data - INFO - [Matrix 90%] 29 alignments
2021-03-01 16:03:34,658 - phyluce_align_get_align_summary_data - INFO - [Matrix 95%] 29 alignments
2021-03-01 16:03:34,659 - phyluce_align_get_align_summary_data - INFO - ------------------------ Character counts -----------------------
2021-03-01 16:03:34,659 - phyluce_align_get_align_summary_data - INFO - [Characters] '-' is present 7,723 times
2021-03-01 16:03:34,659 - phyluce_align_get_align_summary_data - INFO - [Characters] 'A' is present 64,167 times
2021-03-01 16:03:34,659 - phyluce_align_get_align_summary_data - INFO - [Characters] 'C' is present 44,488 times
2021-03-01 16:03:34,660 - phyluce_align_get_align_summary_data - INFO - [Characters] 'G' is present 37,901 times
2021-03-01 16:03:34,660 - phyluce_align_get_align_summary_data - INFO - [Characters] 'T' is present 68,535 times
2021-03-01 16:03:34,660 - phyluce_align_get_align_summary_data - INFO - ========= Completed phyluce_align_get_align_summary_data ========
Alignment cleaning
If you look in one of the files for the alignments we currently have, you will notice that each alignment contains a name that is a combination of the taxon name + the locus name for that taxon. This is not what we want downstream, but it does enable us to ensure the correct data went into each alignment. So, we need to clean our alignments. For the remainder of this tutorial, we will work with the Gblocks trimmed alignments, so we will clean those alignments:
# make sure we are in the correct directory cd uce-tutorial/taxon-sets/all # align the data - turn off trimming and output FASTA phyluce_align_remove_locus_name_from_files \ --alignments mafft-nexus-internal-trimmed-gblocks \ --output mafft-nexus-internal-trimmed-gblocks-clean \ --cores 12 \ --log-path log
The output should be similar to:
2021-03-01 16:05:12,605 - phyluce_align_remove_locus_name_from_files - INFO - === Starting phyluce_align_remove_locus_name_from_files ===
2021-03-01 16:05:12,605 - phyluce_align_remove_locus_name_from_files - INFO - Version: 1.7.0
2021-03-01 16:05:12,605 - phyluce_align_remove_locus_name_from_files - INFO - Commit: None
2021-03-01 16:05:12,606 - phyluce_align_remove_locus_name_from_files - INFO - Argument --alignments: /data/taxon-sets/all/mafft-nexus-internal-trimmed-gblocks
2021-03-01 16:05:12,606 - phyluce_align_remove_locus_name_from_files - INFO - Argument --cores: 12
2021-03-01 16:05:12,606 - phyluce_align_remove_locus_name_from_files - INFO - Argument --input_format: nexus
2021-03-01 16:05:12,607 - phyluce_align_remove_locus_name_from_files - INFO - Argument --log_path: /data/taxon-sets/all/log
2021-03-01 16:05:12,607 - phyluce_align_remove_locus_name_from_files - INFO - Argument --output: /data/taxon-sets/all/mafft-nexus-internal-trimmed-gblocks-clean
2021-03-01 16:05:12,607 - phyluce_align_remove_locus_name_from_files - INFO - Argument --output_format: nexus
2021-03-01 16:05:12,608 - phyluce_align_remove_locus_name_from_files - INFO - Argument --taxa: None
2021-03-01 16:05:12,608 - phyluce_align_remove_locus_name_from_files - INFO - Argument --verbosity: INFO
2021-03-01 16:05:12,608 - phyluce_align_remove_locus_name_from_files - INFO - Getting alignment files
Running...............[continued]
2021-03-01 16:05:12,848 - phyluce_align_remove_locus_name_from_files - INFO - Taxon names in alignments: gallus_gallus,mus_musculus,anolis_carolinensis,alligator_mississippiensis
2021-03-01 16:05:12,849 - phyluce_align_remove_locus_name_from_files - INFO - === Completed phyluce_align_remove_locus_name_from_files ==
The current directory structure should look like (I’ve collapsed a number of branches in the tree):
uce-tutorial
├── assembly.conf
...
├── taxon-sets
│ └── all
│ ├── all-taxa-incomplete.conf
│ ├── all-taxa-incomplete.fasta
│ ├── all-taxa-incomplete.incomplete
│ ├── exploded-fastas
│ ├── log
│ ├── mafft-nexus-edge-trimmed
│ ├── mafft-nexus-internal-trimmed
│ ├── mafft-nexus-internal-trimmed-gblocks
│ └── mafft-nexus-internal-trimmed-gblocks-clean
│ ├── uce-1008.nexus
│ ├── uce-1014.nexus
│ ├── uce-1039.nexus
│ ...
│ └── uce-991.nexus
...
└── uce-search-results
Now, if you look in one of the individual alignment files, you will see that the locus names are removed. We’re ready to generate our final data matrices.
Final data matrices
For the most part, I analyze 75% and 95% complete matrices, where “completeness” for the 75% matrix means that, in a study of 100 taxa (total), all alignments will contain at least 75 of these 100 taxa. Similarly, for the 95% matrix, in a study of 100 taxa, all alignments will contain 95 of these 100 taxa.
Attention
Notice that this metric for completeness does not pay attention to which taxa are in which alignments - so the 75%, above, does not mean that a given taxon will have data in all 75 of 100 alignments.
To create a 75% data matrix, run the following. Notice that the integer following –taxa is the total number of organisms in the study.
# make sure we are in the correct directory
cd uce-tutorial/taxon-sets/all
# the integer following --taxa is the number of TOTAL taxa
# and I use "75p" to denote the 75% complete matrix
phyluce_align_get_only_loci_with_min_taxa \
--alignments mafft-nexus-internal-trimmed-gblocks-clean \
--taxa 4 \
--percent 0.75 \
--output mafft-nexus-internal-trimmed-gblocks-clean-75p \
--cores 12 \
--log-path log
The output should look like the following:
2021-03-01 16:06:56,294 - phyluce_align_get_only_loci_with_min_taxa - INFO - ======= Starting phyluce_align_get_only_loci_with_min_taxa ======
2021-03-01 16:06:56,294 - phyluce_align_get_only_loci_with_min_taxa - INFO - Version: 1.7.0
2021-03-01 16:06:56,294 - phyluce_align_get_only_loci_with_min_taxa - INFO - Commit: None
2021-03-01 16:06:56,295 - phyluce_align_get_only_loci_with_min_taxa - INFO - Argument --alignments: /data/taxon-sets/all/mafft-nexus-internal-trimmed-gblocks-clean
2021-03-01 16:06:56,295 - phyluce_align_get_only_loci_with_min_taxa - INFO - Argument --cores: 12
2021-03-01 16:06:56,295 - phyluce_align_get_only_loci_with_min_taxa - INFO - Argument --input_format: nexus
2021-03-01 16:06:56,295 - phyluce_align_get_only_loci_with_min_taxa - INFO - Argument --log_path: /data/taxon-sets/all/log
2021-03-01 16:06:56,295 - phyluce_align_get_only_loci_with_min_taxa - INFO - Argument --output: /data/taxon-sets/all/mafft-nexus-internal-trimmed-gblocks-clean-75p
2021-03-01 16:06:56,295 - phyluce_align_get_only_loci_with_min_taxa - INFO - Argument --percent: 0.75
2021-03-01 16:06:56,295 - phyluce_align_get_only_loci_with_min_taxa - INFO - Argument --taxa: 4
2021-03-01 16:06:56,296 - phyluce_align_get_only_loci_with_min_taxa - INFO - Argument --verbosity: INFO
2021-03-01 16:06:56,296 - phyluce_align_get_only_loci_with_min_taxa - INFO - Getting alignment files
2021-03-01 16:06:56,534 - phyluce_align_get_only_loci_with_min_taxa - INFO - Copied 189 alignments of 189 total containing ≥ 0.75 proportion of taxa (n = 3)
2021-03-01 16:06:56,534 - phyluce_align_get_only_loci_with_min_taxa - INFO - ====== Completed phyluce_align_get_only_loci_with_min_taxa ======
The current directory structure should look like (I’ve collapsed a number of branches in the tree):
uce-tutorial
├── assembly.conf
...
├── taxon-sets
│ └── all
│ ├── all-taxa-incomplete.conf
│ ├── all-taxa-incomplete.fasta
│ ├── all-taxa-incomplete.incomplete
│ ├── exploded-fastas
│ ├── log
│ ├── mafft-nexus-edge-trimmed
│ ├── mafft-nexus-internal-trimmed
│ ├── mafft-nexus-internal-trimmed-gblocks
│ ├── mafft-nexus-internal-trimmed-gblocks-clean
│ └── mafft-nexus-internal-trimmed-gblocks-clean-75p
│ ├── uce-1008.nexus
│ ├── uce-1014.nexus
│ ├── uce-1039.nexus
│ ...
│ └── uce-991.nexus
...
└── uce-search-results
Preparing data for downstream analysis
Now that we have our 75p data matrix completed, we can generate input files for subsequent phylogenetic analysis. For the most part, I use RAxML or IQTree, both of which will take a phylip-formatted file as input. Formatting our 75p data into a phylip file for these programs is rather easy. To do that, run:
# make sure we are in the correct directory
cd uce-tutorial/taxon-sets/all
# build the concatenated data matrix
phyluce_align_concatenate_alignments \
--alignments mafft-nexus-internal-trimmed-gblocks-clean-75p \
--output mafft-nexus-internal-trimmed-gblocks-clean-75p-raxml \
--phylip \
--log-path log
The output from this program will look like:
2021-03-01 16:09:01,391 - phyluce_align_concatenate_alignments - INFO - ========= Starting phyluce_align_concatenate_alignments =========
2021-03-01 16:09:01,391 - phyluce_align_concatenate_alignments - INFO - Version: 1.7.0
2021-03-01 16:09:01,391 - phyluce_align_concatenate_alignments - INFO - Commit: None
2021-03-01 16:09:01,392 - phyluce_align_concatenate_alignments - INFO - Argument --alignments: /data/taxon-sets/all/mafft-nexus-internal-trimmed-gblocks-clean-75p
2021-03-01 16:09:01,392 - phyluce_align_concatenate_alignments - INFO - Argument --input_format: nexus
2021-03-01 16:09:01,392 - phyluce_align_concatenate_alignments - INFO - Argument --log_path: /data/taxon-sets/all/log
2021-03-01 16:09:01,392 - phyluce_align_concatenate_alignments - INFO - Argument --nexus: False
2021-03-01 16:09:01,392 - phyluce_align_concatenate_alignments - INFO - Argument --output: /data/taxon-sets/all/mafft-nexus-internal-trimmed-gblocks-clean-75p-raxml
2021-03-01 16:09:01,392 - phyluce_align_concatenate_alignments - INFO - Argument --phylip: True
2021-03-01 16:09:01,392 - phyluce_align_concatenate_alignments - INFO - Argument --verbosity: INFO
2021-03-01 16:09:01,393 - phyluce_align_concatenate_alignments - INFO - Reading input alignments in NEXUS format
2021-03-01 16:09:01,393 - phyluce_align_concatenate_alignments - INFO - Getting alignment files
2021-03-01 16:09:01,733 - phyluce_align_concatenate_alignments - INFO - Concatenating files
2021-03-01 16:09:01,796 - phyluce_align_concatenate_alignments - INFO - Writing concatenated alignment to PHYLIP format (with charsets)
2021-03-01 16:09:01,803 - phyluce_align_concatenate_alignments - INFO - ========= Completed phyluce_align_concatenate_alignments ========
Attention
Charsets are now output by default for all data sets. You generally want these and the cost for them is low.
The current directory structure should look like (I’ve collapsed a number of branches in the tree):
uce-tutorial
├── assembly.conf
...
├── taxon-sets
│ └── all
│ ├── all-taxa-incomplete.conf
│ ├── all-taxa-incomplete.fasta
│ ├── all-taxa-incomplete.incomplete
│ ├── exploded-fastas
│ ├── log
│ ├── mafft-nexus-edge-trimmed
│ ├── mafft-nexus-internal-trimmed
│ ├── mafft-nexus-internal-trimmed-gblocks
│ ├── mafft-nexus-internal-trimmed-gblocks-clean
│ ├── mafft-nexus-internal-trimmed-gblocks-clean-75p
│ └── mafft-nexus-internal-trimmed-gblocks-clean-75p-raxml
│ ├── mafft-nexus-internal-trimmed-gblocks-clean-75p.charsets
│ └── mafft-nexus-internal-trimmed-gblocks-clean-75p.phylip
...
└── uce-search-results
If you need to output concatenated data in NEXUS format, you can simply run the same program as above, but change --phylip to --nexus, like:
# make sure we are in the correct directory
cd uce-tutorial/taxon-sets/all
# build the concatenated data matrix
phyluce_align_concatenate_alignments \
--alignments mafft-nexus-internal-trimmed-gblocks-clean-75p \
--output mafft-nexus-internal-trimmed-gblocks-clean-75p-raxml \
--nexus \
--log-path log
Downstream Analysis
The above data are ready to analyze in a program like RAxML or IQTree. See the documentation for those programs to learn how to use them.
If you are performing locus-based inference (e.g. so-called gene-tree, species-tree methods, you can analyze the individual locus alignments present in the folder you created just prior to concatenation (e.g. mafft-nexus-internal-trimmed-gblocks-clean-75p). If you need to convert those files into another format (by default, they are in NEXUS format), you can use phyluce_align_convert_one_align_to_another. For performing analyses to infer a locus-tree from individual alignments, you might look into a program like pargenes. You can also reasonably script IQTree to do this on, for example, an HPC system (we do it using GNU Parallel to send each alignment to one compute core, where we run IQTree on that alignment).
Next Steps
After completing the tutorial, you should have a reasonably good idea of how to use phyluce in a day-to-day situation. If you want to know more about specifics, you can read through the Phyluce in Daily Use sections, which provide additional detail. Also be sure to poke around the other programs that come with phyluce - short list of which you can find in the List of Phyluce Programs.